Быстрый заказ

Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse BID Информация о продукте «Клон cDNA»
Размер кДНК:588bp
Описание кДНК:Full length Clone DNA of Mus musculus BH3 interacting domain death agonist with C terminal Myc tag.
Синоним гена:AI875481, AU022477, 2700049M22Rik, Bid
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50351-ACGRBS15400
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50351-ACRRBS15400
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50351-ANGRBS15400
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50351-ANRRBS15400
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50351-CFRBS13340
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50351-CHRBS13340
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50351-CMRBS13340
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50351-CYRBS13340
Мышь p22 BID Джин клон кДНК в вектор клонированияMG50351-MRBS5130
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50351-NFRBS13340
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50351-NHRBS13340
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50351-NMRBS13340
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50351-NYRBS13340
Мышь p22 BID Джин ORF экспрессии кДНК клона плазмидыMG50351-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the BH3 domain, and is required for its interaction with the Bcl-2 family proteins and for its pro-death activity. BID is important to cell death mediated by these proteases and thus is the sentinel to protease-mediated death signals. Recent studies further indicate that Bid may be more than just a killer molecule, it could be also involved in the maintenance of genomic stability by engaging at mitosis checkpoint. BID is an integrating key regulator of the intrinsic death pathway that amplifies caspase-dependent and caspase-independent execution of neuronal apoptosis. Therefore pharmacological inhibition of BID provides a promising therapeutic strategy in neurological diseases where programmed cell death is prominent. BID is activated by Caspase 8 in response to Fas/TNF-R1 death receptor activation. Activated BID is translocated to mitochondria and induces cytochrome c release, which in turn activates downstream caspases. BID action has been proposed to involve the mitochondrial re-location of its truncated form, tBid, to facilitate the release of apoptogenic proteins like cytochrome c.

  • Gross A. (2006) BID as a double agent in cell life and death. Cell Cycle. 5(6): 582-4.
  • Yin XM. (2007) Bid, a BH3-only multi-functional molecule, is at the cross road of life and death. Gene. 369: 7-19.
  • Esposti MD. (2002) The roles of Bid. Apoptosis. 7(5): 433-40.
  • Yin XM. (2000) Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways. Cell Res. 10(3): 161-7.
  • Yin XM. (2000) Bid, a critical mediator for apoptosis induced by the activation of Fas/TNF-R1 death receptors in hepatocytes. J Mol Med. 78(4): 203-11.
  • Size / Price
    Каталог: MG50351-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.