Быстрый заказ

Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse BCL11A Информация о продукте «Клон cDNA»
Размер кДНК:576bp
Описание кДНК:Full length Clone DNA of Mus musculus B cell CLL/lymphoma 11A (zinc finger protein) with N terminal His tag.
Синоним гена:Evi9, Ctip1, Evi9a, Evi9b, Evi9c, BCL-11A, mKIAA1809, 2810047E18Rik, D930021L15Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52551-ACGRBS15400
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52551-ACRRBS15400
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52551-ANGRBS15400
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52551-ANRRBS15400
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52551-CFRBS13340
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52551-CHRBS13340
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52551-CMRBS13340
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52551-CYRBS13340
Мышь Ctip1/BCL11A Джин клон кДНК в вектор клонированияMG52551-GRBS5130
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52551-NFRBS13340
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52551-NHRBS13340
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52551-NMRBS13340
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52551-NYRBS13340
Мышь Ctip1/BCL11A Джин ORF экспрессии кДНК клона плазмидыMG52551-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52551-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.