Быстрый заказ

Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

  • other Green fluorescent protein / GFP Gene Plasmid Map 5611
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь TNFSF13B Информация о продукте «Клон cDNA»
Размер кДНК:975 bp
Описание кДНК:Full length Clone DNA of Mus musculus tumor necrosis factor (ligand) superfamily, member 13b with C terminal Myc tag.
Синоним гена:BAFF, BLyS, TALL1, THANK, zTNF4, TALL-1, TNFSF20, MGC124060, MGC124061, D8Ertd387e, Tnfsf13b
Участок рестрикции:KpnI + XbaI(6kb+0.98kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with TNFSF13B qPCR primers for gene expression analysis, MP200373 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50352-ACGRBS15400
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50352-ACRRBS15400
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50352-CFRBS13340
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50352-CHRBS13340
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50352-CMRBS13340
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50352-CYRBS13340
Мышь BAFF/BLyS/TNFSF13B Джин клон кДНК в вектор клонированияMG50352-MRBS5130
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50352-NFRBS13340
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50352-NHRBS13340
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50352-NMRBS13340
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50352-NYRBS13340
Мышь BAFF/BLyS/TNFSF13B Джин ORF экспрессии кДНК клона плазмидыMG50352-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is single-pass type II membrane protein, which belongs to the tumor necrosis factor family. BAFF is abundantly expressed in peripheral blood Leukocytes and is specifically expressed in monocytes and macrophages. BAFF is a cytokine and serves as a ligand for receptors TNFRSF13B (TACI), TNFRSF17 (BCMA), and TNFRSF13C (BAFFR). These receptors is a prominent factor in B cell differentiation, homeostasis, and selection. BLyS levels affect survival signals and selective apoptosis of autoantibody-producing B cells. Thus, it acts as a potent B cell activator and has been shown to play an important role in the proliferation and differentiation of B cells. Overexpression of BLyS in mice can lead to clinical and serological features of systemic lupus erythematosus (SLE) and Sjögren's syndrome (SS). BLyS as an attractive therapeutic target in human rheumatic diseases. The ability of BLyS to regulate both the size and repertoire of the peripheral B cell compartment raises the possibility that BLyS and antagonists thereof may form the basis of a therapeutic trichotomy. As an agonist, BLyS protein may enhance humoral immunity in congenital or acquired immunodeficiencies such as those resulting from viral infection or cancer therapy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Nardelli B, et al. (2002) B lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 43(7): 1367-73.
  • Stohl W. (2006) Therapeutic targeting of B lymphocyte stimulator (BLyS) in the rheumatic diseases. Endocr Metab Immune Disord Drug Targets. 6(4): 51-8.
  • Cancro MP, et al. (2009) The role of B lymphocyte stimulator (BLyS) in systemic lupus erythematosus. J Clin Invest. 119(5): 1066-73.
  • Size / Price
    Каталог: MG50352-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Добавить в корзинуЗапрос по оптовому заказу

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.