Bad cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

Bad cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
489 bp
Description
Full length Clone DNA of Mouse BCL2-associated agonist of cell death with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Bad cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

AI325008 cDNA ORF Clone, Mouse; Bbc2 cDNA ORF Clone, Mouse

Bad Background Information

Bcl-2 agonist of cell death (BAD) is a BH3-only member of the Bcl-2 family which possesses important regulatory function in apoptosis. BAD has also been shown to possess many non-apoptotic functions closely linked to cancer including regulation of glycolysis, autophagy, cell cycle progression and immune system development. Oral squamous cell carcinoma (OSCC) is a type of cancer with high morbidity and mortality rates worldwide; it also demonstrates chemotherapeutic resistance. Triterpenoid ursolic acid has been shown to exhibit various biological activities and anticancer effects in several preclinical studies. The apoptosis‑associated signaling showed that ursolic acid decreased the phosphorylation of AKT (Ser473) and B‑cell lymphoma 2 (Bcl‑2)‑associated agonist of cell death (BAD; Ser136), and the protein levels of Bcl‑2 and Bcl‑extra large (Bcl‑xL), and increased the expression of BAD and Bcl‑2‑associated X (Bax) protein in CAR cells.
Full Name
BCL2-associated agonist of cell death
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait