Быстрый заказ

Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ICOSLG Информация о продукте «Клон cDNA»
Размер кДНК:969bp
Описание кДНК:Full length Clone DNA of Mus musculus icos ligand with N terminal Myc tag.
Синоним гена:B7h, GI50, GL50, B7-H2, LICOS, B7RP-1, GL50-B, ICOS-L, Icoslg, Ly115l, AU044799, BG071784, KIAA0653, mKIAA0653, Icosl
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50190-ACGRBS15400
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50190-ACRRBS15400
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50190-CFRBS13340
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50190-CHRBS13340
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50190-CMRBS13340
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50190-CYRBS13340
Мышь ICOSL/ICOS ligand/B7-h2 Джин клон кДНК в вектор клонированияMG50190-MRBS5130
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50190-NFRBS13340
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50190-NHRBS13340
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50190-NMRBS13340
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50190-NYRBS13340
Мышь ICOSL/ICOS ligand/B7-h2 Джин ORF экспрессии кДНК клона плазмидыMG50190-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Inducible co-stimulator ligand (ICOSL), also known as B7-H2, is a member of the B7 family of co-stimulatory molecules related to B7-1 and B7-2. It is a transmembrane glycoprotein with extracellular IgV and IgC domains, and binds to ICOS on activated T cells, thus delivers a positive costimulatory signal for optimal T cell function. The structural features of ICOSL are crucial for its costimulatory function. Present study shows that ICOSL displays a marked oligomerization potential, resembling more like B7-1 than B7-2. B7-H2-dependent signaling may play an active role in a proliferative response rather than in cytokine and chemokine production. The CD28/B7 and ICOS/B7-H2 pathways are both critical for costimulating T cell immune responses. Deficiency in either pathway results in defective T cell activation, cytokine production and germinal center formation.

  • Flesch IE. (2002) Inducible costimulator-ligand (ICOS-L). J Biol Regul Homeost Agents. 16(3): 217-9.
  • Kajiwara K, et al. (2009) Expression and function of the inducible costimulator ligand B7-H2 in human airway smooth muscle cells. Allergol Int. 58(4): 573-83.
  • Wong SC, et al. (2009) Functional hierarchy and relative contribution of the CD28/B7 and ICOS/B7-H2 costimulatory pathways to T cell-mediated delayed-type hypersensitivity. Cell Immunol. 256(1-2): 64-71.
  • Size / Price
    Каталог: MG50190-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.