B7-1 cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

B7-1 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Mouse CD80 molecule with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

B7-1 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

B71 cDNA ORF Clone, Mouse; Cd28l cDNA ORF Clone, Mouse; Ly-53 cDNA ORF Clone, Mouse; Ly53 cDNA ORF Clone, Mouse; MIC17 cDNA ORF Clone, Mouse; TSA1 cDNA ORF Clone, Mouse

B7-1 Background Information

The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD8, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD8 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.
Full Name
CD80 molecule
References
  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait