Быстрый заказ

Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

  • Mouse B7-1 / CD80 natural ORF mammalian expression plasmid, N-Flag tag
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь CD80 Информация о продукте «Клон cDNA»
Размер кДНК:897bp
Описание кДНК:Full length Clone DNA of Mus musculus CD80 molecule with N terminal Flag tag.
Синоним гена:CD80, B7-1, LAB7, CD28LG, CD28LG1
Участок рестрикции:KpnI + XbaI (6kb + 0.9kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 168T/C not causing the amino acid variation., 429 T/C not causing the amino acid variation.
( We provide with CD80 qPCR primers for gene expression analysis, MP200455 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь CD80 Gene Plasmid Map
Mouse B7-1 / CD80 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50446-ACGRBS15400
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50446-ACRRBS15400
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50446-CFRBS13340
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50446-CHRBS13340
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50446-CMRBS13340
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50446-CYRBS13340
Мышь CD80/B7-1 Джин клон кДНК в вектор клонированияMG50446-GRBS5130
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50446-NFRBS13340
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50446-NHRBS13340
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50446-NMRBS13340
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50446-NYRBS13340
Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмидыMG50446-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD80 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.
  • Size / Price
    Каталог: MG50446-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.