Быстрый заказ

Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь CD80 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_009855.2
    Размер кДНК:897bp
    Описание кДНК:Full length Clone DNA of Mus musculus CD80 molecule with C terminal His tag.
    Синоним гена:CD80, B7-1, LAB7, CD28LG, CD28LG1
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD80 qPCR primers for gene expression analysis, MP200455 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50446-ACGRBS15400
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50446-ACRRBS15400
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50446-CFRBS13340
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50446-CHRBS13340
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50446-CMRBS13340
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50446-CYRBS13340
    Мышь CD80/B7-1 Джин клон кДНК в вектор клонированияMG50446-GRBS5130
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50446-NFRBS13340
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50446-NHRBS13340
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50446-NMRBS13340
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50446-NYRBS13340
    Мышь CD80/B7-1 Джин ORF экспрессии кДНК клона плазмидыMG50446-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD80 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.

    Immune Checkpoint
    Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
    Immune Checkpoint Proteins
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.
  • Size / Price
    Каталог: MG50446-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».