After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse B4GALT7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_146045.1
Размер кДНК:984bp
Описание кДНК:Full length Clone DNA of Mus musculus xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I).
Синоним гена:B4galt7
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52473-ACGRBS15400
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52473-ACRRBS15400
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52473-CFRBS13340
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52473-CHRBS13340
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52473-CMRBS13340
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52473-CYRBS13340
Мышь B4GALT7 Джин клон кДНК в вектор клонированияMG52473-GRBS5130
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52473-NFRBS13340
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52473-NHRBS13340
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52473-NMRBS13340
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52473-NYRBS13340
Мышь B4GALT7 Джин ORF экспрессии кДНК клона плазмидыMG52473-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52473-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».