Быстрый заказ

Text Size:AAA

Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse B4GALNT1 Информация о продукте «Клон cDNA»
Размер кДНК:1602bp
Описание кДНК:Full length Clone DNA of Mus musculus beta-1,4-N-acetyl-galactosaminyl transferase 1 with N terminal Myc tag.
Синоним гена:Ggm2, Ggm-2, Galgt1, GalNAcT, GalNAc-T, Gal-NAc-T, 4933429D13Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52579-ACGRBS16760
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52579-ACRRBS16760
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52579-CFRBS14710
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52579-CHRBS14710
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52579-CMRBS14710
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52579-CYRBS14710
Мышь B4GALNT1 Джин клон кДНК в вектор клонированияMG52579-GRBS5130
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52579-NFRBS14710
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52579-NHRBS14710
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52579-NMRBS14710
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52579-NYRBS14710
Мышь B4GALNT1 Джин ORF экспрессии кДНК клона плазмидыMG52579-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.