After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ANGPTL4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020581.2
Размер кДНК:1233bp
Описание кДНК:Full length Clone DNA of Mus musculus angiopoietin-like 4 with C terminal Myc tag.
Синоним гена:Arp4, Bk89, Fiaf, Ng27, Pgar, Hfarp, Pgarg, Pp1158, Angptl4
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50356-ACGRBS15400
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50356-ACRRBS15400
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50356-CFRBS13340
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50356-CHRBS13340
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50356-CMRBS13340
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50356-CYRBS13340
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин клон кДНК в вектор клонированияMG50356-MRBS5130
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50356-NFRBS13340
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50356-NHRBS13340
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50356-NMRBS13340
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50356-NYRBS13340
Мышь ANGPTL4 / angiopoietin-like Белок 4 Джин ORF экспрессии кДНК клона плазмидыMG50356-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

Ссылки
  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Каталог: MG50356-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».