Быстрый заказ

Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ATP6AP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027439.4
Размер кДНК:1053bp
Описание кДНК:Full length Clone DNA of Mus musculus ATPase, H+ transporting, lysosomal accessory protein 2.
Синоним гена:M8-9, (P)RR, Atp6ip2, APT6M8-9, ATP6M8-9, 5730403E06Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51375-ACGRBS15400
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51375-ACRRBS15400
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51375-CFRBS13340
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51375-CHRBS13340
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51375-CMRBS13340
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51375-CYRBS13340
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51375-NFRBS13340
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51375-NHRBS13340
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51375-NMRBS13340
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51375-NYRBS13340
Мышь ATP6AP2/ATP6IP2 Джин клон кДНК в вектор клонированияMG51375-URBS5130
Мышь ATP6AP2/ATP6IP2 Джин ORF экспрессии кДНК клона плазмидыMG51375-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51375-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».