After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ATP5D Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025313.2
Размер кДНК:507bp
Описание кДНК:Full length Clone DNA of Mus musculus ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit with C terminal Flag tag.
Синоним гена:C85518, AA960090, AI876556, AU020773, 0610008F14Rik, 1500000I11Rik
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52204-ACGRBS15400
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52204-ACRRBS15400
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52204-ANGRBS15400
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52204-ANRRBS15400
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52204-CFRBS13340
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52204-CHRBS13340
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52204-CMRBS13340
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52204-CYRBS13340
Мышь ATP5D Джин клон кДНК в вектор клонированияMG52204-GRBS5130
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52204-NFRBS13340
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52204-NHRBS13340
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52204-NMRBS13340
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52204-NYRBS13340
Мышь ATP5D Джин ORF экспрессии кДНК клона плазмидыMG52204-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ATP5D is a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase consists of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). ATP5D gene encodes the delta subunit of the catalytic core.

Ссылки
  • Jordan EM. et al., 1992, Biochim Biophys Acta 1130 (1): 123-6.
  • Yoshida M. et al., 2001, Nat Rev Mol Cell Biol. 2 (9): 669-77.
  • Hochstrasser DF. et al., 1993, Electrophoresis. 13 (12): 992-1001.
  • Size / Price
    Каталог: MG52204-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».