Быстрый заказ

Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ATP5B Информация о продукте «Клон cDNA»
Размер кДНК:1590bp
Описание кДНК:Full length Clone DNA of Mus musculus ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit with N terminal His tag.
Синоним гена:Atp5b
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51412-ACGRBS16760
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51412-ACRRBS16760
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51412-ANGRBS16760
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51412-ANRRBS16760
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51412-CFRBS14710
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51412-CHRBS14710
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51412-CMRBS14710
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51412-CYRBS14710
Мышь ATP5B Джин клон кДНК в вектор клонированияMG51412-GRBS5130
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51412-NFRBS14710
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51412-NHRBS14710
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51412-NMRBS14710
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51412-NYRBS14710
Мышь ATP5B Джин ORF экспрессии кДНК клона плазмидыMG51412-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51412-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.