After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ATF2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001025093.1
Размер кДНК:1464bp
Описание кДНК:Full length Clone DNA of Mus musculus activating transcription factor 2, isfrom 1.
Синоним гена:mXBP, Atf-2, Creb2, CRE-BP, D18875, MGC105211, MGC105222, D130078H02Rik, Tg(Gzma-Klra1)7Wum, Atf2
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50262-ACGRBS15400
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50262-ACRRBS15400
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50262-ANGRBS15400
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50262-ANRRBS15400
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50262-CFRBS13340
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50262-CHRBS13340
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50262-CMRBS13340
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50262-CYRBS13340
Мышь ATF2 Джин клон кДНК в вектор клонированияMG50262-MRBS5130
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50262-NFRBS13340
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50262-NHRBS13340
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50262-NMRBS13340
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50262-NYRBS13340
Мышь ATF2 Джин ORF экспрессии кДНК клона плазмидыMG50262-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Activating transcription factor 2, also known as ATF2, is a member of the leucine zipper family of DNA-binding proteins that binds to the cAMP response element. Its activity is enhanced after phosphorylation by stress-activated protein kinases such as c-Jun N-terminal kinase and p38. ATF2 has been found to be a target of the JNK signal transduction pathway and mediate adenovirus E1A-inducible transcriptional activation. ATF2 is also been reported playing roles in TGF-β signaling pathway. It has been shown that the transcription factor ATF2 is bound by a hetero-oligomer of Smad3 and Smad4 upon TGF-β stimulation. Studies indicate that ATF-2 plays a central role in TGF-β signaling by acting as a common nuclear target of both Smad and TAK1 pathways. 

Ссылки
  • Livingstone C, et al. (1995) ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14 (8): 1785-97.
  • Gupta S, et al. (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science . 267 (5196): 389-93.
  • Sano YJ, et al. (1999) ATF-2 Is a Common Nuclear Target of Smad and TAK1 Pathways in Transforming Growth Factor-_ Signaling. The Journal of Biological Chemistry. 274: 8949-57.
  • Size / Price
    Каталог: MG50262-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».