After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ARPC4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026552.3
Размер кДНК:507bp
Описание кДНК:Full length Clone DNA of Mus musculus actin related protein 2/3 complex, subunit 4.
Синоним гена:20kDa, p20-Arc, AI327076, 5330419I20Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51362-ACGRBS15396
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51362-ACRRBS15396
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51362-ANGRBS15396
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51362-ANRRBS15396
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51362-CFRBS13343
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51362-CHRBS13343
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51362-CMRBS13343
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51362-CYRBS13343
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51362-NFRBS13343
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51362-NHRBS13343
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51362-NMRBS13343
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51362-NYRBS13343
Мышь ARPC4 Джин клон кДНК в вектор клонированияMG51362-URBS5132
Мышь ARPC4 Джин ORF экспрессии кДНК клона плазмидыMG51362-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51362-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».