After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ARPC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_029711.1
Размер кДНК:903bp
Описание кДНК:Full length Clone DNA of Mus musculus actin related protein 2/3 complex, subunit 2 with N terminal His tag.
Синоним гена:34kDa, p34-Arc, MGC141099, 2210023N03Rik, Arpc2
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50745-ACGRBS15400
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50745-ACRRBS15400
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50745-ANGRBS15400
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50745-ANRRBS15400
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50745-CFRBS13340
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50745-CHRBS13340
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50745-CMRBS13340
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50745-CYRBS13340
Мышь ARPC2 Джин клон кДНК в вектор клонированияMG50745-GRBS5130
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50745-NFRBS13340
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50745-NHRBS13340
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50745-NMRBS13340
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50745-NYRBS13340
Мышь ARPC2 Джин ORF экспрессии кДНК клона плазмидыMG50745-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50745-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».