ARMCX2 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

ARMCX2 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2355 bp
Description
Full length Clone DNA of Mouse armadillo repeat containing, X-linked 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ARMCX2 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

3230401N03Rik cDNA ORF Clone, Mouse; AI043003 cDNA ORF Clone, Mouse; ALEX2 cDNA ORF Clone, Mouse

ARMCX2 Background Information

Full Name
armadillo repeat containing, X-linked 2

ARMCX2 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed