ARMC1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52976-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ARMC1 Reagents

CRO Services

Product recommended


All ARMC1 Reagents

ARMC1 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
849 bp
Description
Full length Clone DNA of Mouse armadillo repeat containing 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARMC1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

2310016N05Rik cDNA ORF Clone, Mouse;2900046P06Rik cDNA ORF Clone, Mouse;3110009G21Rik cDNA ORF Clone, Mouse;AA409258 cDNA ORF Clone, Mouse;Arcp cDNA ORF Clone, Mouse;AW048872 cDNA ORF Clone, Mouse;C330014L16Rik cDNA ORF Clone, Mouse

ARMC1 Background Information

Full Name
armadillo repeat containing 1

ARMC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARMC1 cDNA ORF Clone in Cloning Vector, Rat RG8A1702-U
ARMC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1702-ACGLN

ARMC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARMC1 cDNA ORF Clone in Cloning Vector, Mouse MG52976-G
ARMC1 cDNA ORF Clone, Mouse, untagged MG52976-UT
ARMC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52976-ACG
ARMC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52976-ACGLN
ARMC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52976-ANG
ARMC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52976-ACR
ARMC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52976-ANR
ARMC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52976-CF
ARMC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52976-NF
ARMC1 cDNA ORF Clone, Mouse, C-His tag MG52976-CH
ARMC1 cDNA ORF Clone, Mouse, N-His tag MG52976-NH
ARMC1 cDNA ORF Clone, Mouse, C-HA tag MG52976-CY
ARMC1 cDNA ORF Clone, Mouse, N-HA tag MG52976-NY
ARMC1 cDNA ORF Clone, Mouse, C-Myc tag MG52976-CM

ARMC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARMC1 cDNA ORF Clone in Cloning Vector, Human HG17136-U
ARMC1 cDNA ORF Clone, Human, untagged HG17136-UT
ARMC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17136-ACG
ARMC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17136-ACGLN
ARMC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17136-ANG
ARMC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17136-ACR
ARMC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17136-ANR
ARMC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17136-CF
ARMC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17136-NF
ARMC1 cDNA ORF Clone, Human, C-His tag HG17136-CH
ARMC1 cDNA ORF Clone, Human, N-His tag HG17136-NH
ARMC1 cDNA ORF Clone, Human, C-HA tag HG17136-CY
ARMC1 cDNA ORF Clone, Human, N-HA tag HG17136-NY
ARMC1 cDNA ORF Clone, Human, C-Myc tag HG17136-CM
ARMC1 cDNA ORF Clone, Human, N-Myc tag HG17136-NM
info info
添加购物车成功! 添加购物车失败!