ARL8B cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51602-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ARL8B Reagents

CRO Services

Product recommended


All ARL8B Reagents

ARL8B cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
561 bp
Description
Full length Clone DNA of Mouse ADP-ribosylation factor-like 8B

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARL8B cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

2610313E07Rik cDNA ORF Clone, Mouse;3100002J04Rik cDNA ORF Clone, Mouse;Arl10c cDNA ORF Clone, Mouse;gie1 cDNA ORF Clone, Mouse

ARL8B Background Information

Full Name
ADP-ribosylation factor-like 8B

ARL8B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARL8B cDNA ORF Clone in Cloning Vector, Rat RG89083-U
ARL8B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89083-ACGLN

ARL8B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARL8B cDNA ORF Clone in Cloning Vector, Mouse MG51602-U
ARL8B cDNA ORF Clone, Mouse, untagged MG51602-UT
ARL8B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51602-ACG
ARL8B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51602-ACGLN
ARL8B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51602-ANG
ARL8B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51602-ACR
ARL8B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51602-ANR
ARL8B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51602-CF
ARL8B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51602-NF
ARL8B cDNA ORF Clone, Mouse, C-His tag MG51602-CH
ARL8B cDNA ORF Clone, Mouse, N-His tag MG51602-NH
ARL8B cDNA ORF Clone, Mouse, C-HA tag MG51602-CY
ARL8B cDNA ORF Clone, Mouse, N-HA tag MG51602-NY
ARL8B cDNA ORF Clone, Mouse, N-Myc tag MG51602-NM
ARL8B qPCR Primer Pairs, Mouse MP201485

ARL8B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARL8B cDNA ORF Clone in Cloning Vector, Human HG14668-G
ARL8B cDNA ORF Clone, Human, untagged HG14668-UT
ARL8B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14668-ACGLN
ARL8B cDNA ORF Clone, Human, C-GFPSpark® tag HG14668-ACG
ARL8B cDNA ORF Clone, Human, N-GFPSpark® tag HG14668-ANG
ARL8B cDNA ORF Clone, Human, C-OFPSpark® tag HG14668-ACR
ARL8B cDNA ORF Clone, Human, N-OFPSpark® tag HG14668-ANR
ARL8B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14668-CF
ARL8B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14668-NF
ARL8B cDNA ORF Clone, Human, C-His tag HG14668-CH
ARL8B cDNA ORF Clone, Human, N-His tag HG14668-NH
ARL8B cDNA ORF Clone, Human, C-HA tag HG14668-CY
ARL8B cDNA ORF Clone, Human, N-HA tag HG14668-NY
ARL8B cDNA ORF Clone, Human, C-Myc tag HG14668-CM
ARL8B cDNA ORF Clone, Human, N-Myc tag HG14668-NM
ARL8B qPCR Primer Pairs, Human HP103302
info info
添加购物车成功! 添加购物车失败!