Быстрый заказ

Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ARHGEF7 Информация о продукте «Клон cDNA»
Размер кДНК:1941bp
Описание кДНК:Full length Clone DNA of Mus musculus Rho guanine nucleotide exchange factor (GEF7) with N terminal Flag tag.
Синоним гена:PIX, Cool, Pak3bp, cool-1, p85SPR, betaPix, p85Cool1, betaPix-b, betaPix-c, mKIAA0142
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52925-ACGRBS16764
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52925-ACRRBS16764
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52925-ANGRBS16764
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52925-ANRRBS16764
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52925-CFRBS14711
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52925-CHRBS14711
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52925-CMRBS14711
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52925-CYRBS14711
Мышь ARHGEF7/β-PIX Джин клон кДНК в вектор клонированияMG52925-GRBS5132
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52925-NFRBS14711
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52925-NHRBS14711
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52925-NMRBS14711
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52925-NYRBS14711
Мышь ARHGEF7/β-PIX Джин ORF экспрессии кДНК клона плазмидыMG52925-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52925-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.