Быстрый заказ

Text Size:AAA

Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse APPBP2 Информация о продукте «Клон cDNA»
Размер кДНК:1758bp
Описание кДНК:Full length Clone DNA of Mus musculus amyloid beta precursor protein (cytoplasmic tail) binding protein 2 with N terminal His tag.
Синоним гена:PAT1; AI465480; 1300003O07Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51984-ACGRBS16760
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51984-ACRRBS16760
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51984-ANGRBS16760
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51984-ANRRBS16760
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51984-CFRBS5130
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51984-CHRBS14710
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51984-CMRBS14710
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51984-CYRBS14710
Mouse APPBP2 Gene cDNA clone plasmidMG51984-GRBS5130
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51984-NFRBS14710
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51984-NHRBS14710
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51984-NMRBS14710
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51984-NYRBS14710
Мышь PAT1/APPBP2 Джин клон кДНК в вектор клонированияMG51984-URBS5130
Мышь PAT1/APPBP2 Джин ORF экспрессии кДНК клона плазмидыMG51984-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51984-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.