After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse APP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007471.2
Размер кДНК:2088bp
Описание кДНК:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor protein with C terminal Flag tag.
Синоним гена:Adap, Cvap, Abeta, appican, betaAPP, AL024401, E030013M08Rik, App
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-mAPP-Flag
Участок рестрикции:HindIII + XbaI (6kb + 2.13kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 G>A, 498 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse APP Gene Plasmid Map
Mouse APP / PN2 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50402-ACGRBS16760
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50402-ACRRBS16760
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50402-CFRBS14710
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50402-CHRBS14710
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50402-CMRBS14710
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50402-CYRBS14710
Мышь Amyloid beta A4 Белок Джин клон кДНК в вектор клонированияMG50402-MRBS5130
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50402-NFRBS14710
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50402-NHRBS14710
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50402-NMRBS14710
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50402-NYRBS14710
Мышь Amyloid beta A4 Белок Джин ORF экспрессии кДНК клона плазмидыMG50402-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many tissues and concentrated in the synapses of neurons, and is suggested as a regulator of synapse formation and neural plasticity. APP can be processed by two different proteolytic pathways. In one pathway, APP is cleaved by β- and γ-secretase to produce the amyloid-β-protein (Aβ, Abeta, beta-amyloid) which is the principal component of the amyloid plaques, the major pathological hallmark of Alzheimer’s disease (AD), while in the other pathway, α-secretase is involved in the cleavage of APP whose product exerts antiamyloidogenic effect and prevention of the Aβ peptide formation. The aberrant accumulation of aggregated beta-amyloid peptides (Abeta) as plaques is a hallmark of AD neuropathology and reduction of Abeta has become a leading direction of emerging experimental therapies for the disease. Besides this pathological function of Abeta, recently published data reveal that Abeta also has an essential physiological role in lipid homeostasis. Cholesterol increases Abeta production, and conversely A beta production causes a decrease in cholesterol synthesis. Abeta may be part of a mechanism controlling synaptic activity, acting as a positive regulator presynaptically and a negative regulator postsynaptically. The pathological accumulation of oligomeric Abeta assemblies depresses excitatory transmission at the synaptic level, but also triggers aberrant patterns of neuronal circuit activity and epileptiform discharges at the network level. Abeta-induced dysfunction of inhibitory interneurons likely increases synchrony among excitatory principal cells and contributes to the destabilization of neuronal networks. There is evidence that beta-amyloid can impair blood vessel function. Vascular beta-amyloid deposition, also known as cerebral amyloid angiopathy, is associated with vascular dysfunction in animal and human studies. Alzheimer disease is associated with morphological changes in capillary networks, and soluble beta-amyloid produces abnormal vascular responses to physiological and pharmacological stimuli.

Ссылки
  • Grimm MO, et al. (2007) Amyloid beta as a regulator of lipid homeostasis. Trends Mol Med. 13(8): 337-44.
  • Smith EE, et al. (2009) Beta-amyloid, blood vessels, and brain function. Stroke. 40(7): 2601-6.
  • Gouras GK, et al. (2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer's disease. Acta Neuropathol. 119(5): 523-41.
  • Palop JJ, et al. (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's disease: from synapses toward neural networks. Nat Neurosci. 13(7): 812-8.
  • Size / Price
    Каталог: MG50402-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human CD151 ORF mammalian expression plasmid, C-Flag tag
    • Mouse APP / PN2 natural ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».