APOP1/APOPT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

APOP1/APOPT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
579 bp
Description
Full length Clone DNA of Mouse apoptogenic, mitochondrial 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

APOP1/APOPT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

1700081D05Rik cDNA ORF Clone, Mouse; 2810002N01Rik cDNA ORF Clone, Mouse; Apop-1 cDNA ORF Clone, Mouse; Apop1 cDNA ORF Clone, Mouse

APOP1/APOPT1 Background Information

Full Name
apoptogenic 1, mitochondrial
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait