After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse APOE Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009696.3
Размер кДНК:936bp
Описание кДНК:Full length Clone DNA of Mus musculus apolipoprotein E with C terminal HA tag.
Синоним гена:AI255918
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51201-ACGRBS15400
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51201-ACRRBS15400
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51201-CFRBS13340
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51201-CHRBS13340
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51201-CMRBS13340
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51201-CYRBS13340
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51201-NFRBS13340
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51201-NHRBS13340
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51201-NMRBS13340
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51201-NYRBS13340
Мышь ApoE/Apolipoprotein E Джин клон кДНК в вектор клонированияMG51201-URBS5130
Мышь ApoE/Apolipoprotein E Джин ORF экспрессии кДНК клона плазмидыMG51201-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299 amino acid residues. There are three isoforms in human (apoE2, apoE3, and apoE4) due to different amino acid residues at positions 112 and 158. ApoE is synthesized predominantly in the liver, but also by cells in the spleen, brain, lung, kidney, ovary, adrenal, and muscle tissues. Hepatic parenchyma cells are the main apoE producing cells in mammalian body, probably accounting for two thirds to three fourths of the plasma apoE . In the nervous system, apoE mRNA is present in neurons, astrocytes, ependymal cells, nonmyelinating Schwann cells, but not in microglia, oligodendroglia, choroidal cells, or myelinating Schwann cells. ApoE produced by mammalian cells exists in different forms, monomers, dimers, modified, unmodified, lipid-rich, and lipid-poor, and so forth. ApoE plays a double-role in immune responses. Both apoE containing lipoproteins and multimers of synthetic apoE peptides inhibited proliferation of cultured lymphocytes by inhibiting DNA synthesis and reducing phospholipid turnover in T cells. ApoE can also affect innate and acquired immune responses in vitro by its ability to suppress stimulation of cultured neutrophils. ApoE can bind lipopolysaccharide (LPS), attenuate the inflammatory response, and thus reduce LPS induced lethality. Injection of LPS stimulated higher expression of inflammatory cytokines like interleukin (IL)-1β, IL-12, and interferon-γ (IFN-γ), as well as IL-6.

Ссылки
  • Mahley RW. (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science. 240(4852): 622-30.
  • Aleshkov S, et al. (1989) Interaction of nascent apoe2, apoe3, and apoe4 isoforms expressed in mammalian cells with amyloid peptide. Relevance to Alzheimer's disease. Biochemistry. 36(34): 10571-80.
  • Hussain MM, et al. (1997) Synthesis, modification, and flotation properties of rat hepatocyte apolipoproteins. Biochimica et Biophysica Acta. 101(1): 90-101.
  • Size / Price
    Каталог: MG51201-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».