Быстрый заказ

Text Size:AAA

Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse APLP1 Информация о продукте «Клон cDNA»
Размер кДНК:1965bp
Описание кДНК:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor-like protein 1 with C terminal His tag.
Синоним гена:Aplp1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51730-ACGRBS16760
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51730-ACRRBS16760
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51730-CFRBS14710
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51730-CHRBS14710
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51730-CMRBS14710
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51730-CYRBS14710
Мышь APLP1 / Amyloid-like Белок 1 Джин клон кДНК в вектор клонированияMG51730-GRBS5130
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51730-NFRBS14710
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51730-NHRBS14710
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51730-NMRBS14710
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51730-NYRBS14710
Мышь APLP1 / Amyloid-like Белок 1 Джин ORF экспрессии кДНК клона плазмидыMG51730-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

APLP1, also known as amyloid-like protein 1, is a member of the highly conserved amyloid precursor protein gene family. APLP1 is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. APLP1, together with APLP2, are important modulators of glucose. APLP1 may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. APLP1 also is a mammalian homologue of amyloid precursor protein (APP). APP is a type I membrane protein that is genetically linked to Alzheimer's disease.

  • Wasco W. et al., 1993, Genomics. 15 (1): 237-9.
  • Needham BE. et al., 2008, J Pathol. 215 (2): 155-63.
  • Bayer TA. et al., 2000, Mol Psychiatry. 4 (6): 524-8.
  • Lee S. et al., 2011, Biochemistry. 50 (24): 5453-64.
  • Size / Price
    Каталог: MG51730-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.