Serum Amyloid P cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

Serum Amyloid P cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Mouse serum amyloid P-component with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Serum Amyloid P cDNA ORF Clone, Mouse, N-His tag: Alternative Names

Sap cDNA ORF Clone, Mouse

Serum Amyloid P Background Information

Serum amyloid P component (SAP) is the identical serum form of amyloid P component (AP), a highly preserved plasma protein named for its ubiquitous presence in amyloid deposits. As a normal plasma protein first identified as the pentagonal constituent of in vivo pathological deposits called "amyloid". Serum amyloid P component represents another member of the pentraxin family, a highly conserved group of molecules that may play a role in innate immunity. SAP is a key negative regulator for innate immune responses to DNA and may be partly responsible for the insufficient immune responses after DNA vaccinations in humans. SAP suppression may be a novel strategy for improving efficacy of human DNA vaccines and requires further clinical investigations.
Full Name
amyloid P component, serum
References
  • Wang Y, et al. (2011) Human serum amyloid P functions as a negative regulator of the innate and adaptive immune responses to DNA vaccines. J Immunol. 186(5): 2860-70.
  • Hawkins PN. (2002) Serum amyloid P component scintigraphy for diagnosis and monitoring amyloidosis. Curr Opin Nephrol Hypertens. 11(6): 649-55.
  • Noursadeghi M, et al. (2000) Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc Natl Acad Sci U S A. 97: 14584-9.
  • de Haas CJ. (1999) New insights into the role of serum amyloid P component, a novel lipopolysaccharide-binding protein. FEMS Immunol Med Microbiol. 26(3-4): 197-202.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait