Быстрый заказ

Text Size:AAA

Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse APCS Информация о продукте «Клон cDNA»
Размер кДНК:675bp
Описание кДНК:Full length Clone DNA of Mus musculus serum amyloid P-component with N terminal His tag.
Синоним гена:Sap
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50113-ACGRBS15400
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50113-ACRRBS15400
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50113-CFRBS13340
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50113-CHRBS13340
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50113-CMRBS13340
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50113-CYRBS13340
Мышь Serum amyloid P component Джин клон кДНК в вектор клонированияMG50113-MRBS5130
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50113-NFRBS13340
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50113-NHRBS13340
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50113-NMRBS13340
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50113-NYRBS13340
Мышь Serum amyloid P component Джин ORF экспрессии кДНК клона плазмидыMG50113-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Serum amyloid P component (SAP) is the identical serum form of amyloid P component (AP), a highly preserved plasma protein named for its ubiquitous presence in amyloid deposits. As a normal plasma protein first identified as the pentagonal constituent of in vivo pathological deposits called "amyloid". Serum amyloid P component represents another member of the pentraxin family, a highly conserved group of molecules that may play a role in innate immunity. SAP is a key negative regulator for innate immune responses to DNA and may be partly responsible for the insufficient immune responses after DNA vaccinations in humans. SAP suppression may be a novel strategy for improving efficacy of human DNA vaccines and requires further clinical investigations.

  • Wang Y, et al. (2011) Human serum amyloid P functions as a negative regulator of the innate and adaptive immune responses to DNA vaccines. J Immunol. 186(5): 2860-70.
  • Hawkins PN. (2002) Serum amyloid P component scintigraphy for diagnosis and monitoring amyloidosis. Curr Opin Nephrol Hypertens. 11(6): 649-55.
  • Noursadeghi M, et al. (2000) Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc Natl Acad Sci U S A. 97: 14584-9.
  • de Haas CJ. (1999) New insights into the role of serum amyloid P component, a novel lipopolysaccharide-binding protein. FEMS Immunol Med Microbiol. 26(3-4): 197-202.
  • Size / Price
    Каталог: MG50113-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.