Быстрый заказ

Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse APBB1 Информация о продукте «Клон cDNA»
Размер кДНК:2133bp
Описание кДНК:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor protein-binding, family B, member 1 with C terminal His tag.
Синоним гена:Rir, Fe65
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51732-ACGRBS16760
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51732-ACRRBS16760
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51732-ANGRBS16760
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51732-ANRRBS16760
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51732-CFRBS14710
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51732-CHRBS14710
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51732-CMRBS14710
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51732-CYRBS14710
Мышь FE65/APBB1 Джин клон кДНК в вектор клонированияMG51732-GRBS5130
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51732-NFRBS14710
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51732-NHRBS14710
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51732-NMRBS14710
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51732-NYRBS14710
Мышь FE65/APBB1 Джин ORF экспрессии кДНК клона плазмидыMG51732-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51732-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.