Apc2/ANAPC2 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

Apc2/ANAPC2 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2514 bp
Description
Full length Clone DNA of Mouse anaphase promoting complex subunit 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Apc2/ANAPC2 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

9230107K09Rik cDNA ORF Clone, Mouse; AL024279 cDNA ORF Clone, Mouse; Apc2 cDNA ORF Clone, Mouse; Emi4 cDNA ORF Clone, Mouse; Imi4 cDNA ORF Clone, Mouse; mKIAA1406 cDNA ORF Clone, Mouse

Apc2/ANAPC2 Background Information

Full Name
anaphase promoting complex subunit 2
Add to Cart Successfully Add to Cart Failed