After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ALOX5AP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009663.1
Размер кДНК:486bp
Описание кДНК:Full length Clone DNA of Mus musculus arachidonate 5-lipoxygenase activating protein with N terminal His tag.
Синоним гена:Flap
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52815-ACGRBS15400
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52815-ACRRBS15400
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52815-ANGRBS15400
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52815-ANRRBS15400
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52815-CFRBS13340
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52815-CHRBS13340
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52815-CMRBS13340
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52815-CYRBS13340
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин клон кДНК в вектор клонированияMG52815-GRBS5130
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52815-NFRBS13340
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52815-NHRBS13340
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52815-NMRBS13340
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52815-NYRBS13340
Мышь ALOX5AP / 5-lipoxygenase-activating Белок Джин ORF экспрессии кДНК клона плазмидыMG52815-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

Ссылки
  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    Каталог: MG52815-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».