Быстрый заказ

Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ACVRL1 Информация о продукте «Клон cDNA»
Размер кДНК:1509bp
Описание кДНК:Full length Clone DNA of Mus musculus activin A receptor, type I I-like 1 with N terminal Myc tag.
Синоним гена:Alk1, Alk-1, Acvrlk1, AI115505, AI427544, Acvrl1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50208-ACGRBS16760
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50208-ACRRBS16760
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50208-CFRBS14710
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50208-CHRBS14710
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50208-CMRBS14710
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50208-CYRBS14710
Мышь ALK-1/ACVRL1 Джин клон кДНК в вектор клонированияMG50208-MRBS5130
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50208-NFRBS14710
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50208-NHRBS14710
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50208-NMRBS14710
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50208-NYRBS14710
Мышь ALK-1/ACVRL1 Джин ORF экспрессии кДНК клона плазмидыMG50208-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific type I receptor of the TGF-beta (transforming growth factor beta) receptor family of ligands. On ligand binding, a heteromeric receptor complex forms consisting of two type II and two type I transmembrane serine/threonine kinases. ACVRL1 protein is expressed in certain blood vessels of kidney, spleen, heart and intestine, serving as an important role during vascular development. Mutations in ACVRL1 gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2 and vascular disease.

  • French Rendu-Osler network,et al. (2004) Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France. Hum Mutat. 23(4): 289-299.
  • Simon M, et al. (2006) Association of a polymorphism of the ACVRL1 gene with sporadic arteriovenous malformations of the central nervous system. J Neurosurg. 104(6): 945-9.
  • Argyriou L, et al. (2006) Novel mutations in the ENG and ACVRL1 genes causing hereditary hemorrhagic teleangiectasia. Int J Mol Med. 17(4):655-9.
  • Size / Price
    Каталог: MG50208-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.