Быстрый заказ

Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ALDOA Информация о продукте «Клон cDNA»
Размер кДНК:1095bp
Описание кДНК:Full length Clone DNA of Mus musculus aldolase A, fructose-bisphosphate with N terminal His tag.
Синоним гена:Aldo1; Aldo-1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52539-ACGRBS15396
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52539-ACRRBS15396
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52539-ANGRBS15396
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52539-ANRRBS15396
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52539-CFRBS13343
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52539-CHRBS13343
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52539-CMRBS13343
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52539-CYRBS13343
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52539-NFRBS13343
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52539-NHRBS13343
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52539-NMRBS13343
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52539-NYRBS13343
Мышь aldolase A/ALDOA Джин клон кДНК в вектор клонированияMG52539-URBS5132
Мышь aldolase A/ALDOA Джин ORF экспрессии кДНК клона плазмидыMG52539-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52539-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.