ALDH7A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

ALDH7A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1536 bp
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase family 7, member A1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ALDH7A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

Atq1 cDNA ORF Clone, Mouse; D18Wsu181e cDNA ORF Clone, Mouse

ALDH7A1 Background Information

ALDH7A1 (Aldehyde dehydrogenase 7 family, member A1) is a member of subfamily 7 in the aldehyde dehydrogenase family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. Mammalian ALDH7A1 is homologous to plant ALDH7B1 which protects against various forms of stress such as increased salinity, dehydration and treatment with oxidants or pesticides. In mammals, ALDH7A1 is known to play a primary role during lysine catabolism through the NAD+-dependent oxidative conversion of aminoadipate semialdehyde (AASA) to its corresponding carboxylic acid, α-aminoadipic acid. Deleterious mutations in human ALDH7A1 are responsible for pyridoxine-dependent and folinic acid-responsive seizures. ALDH7A1 is a novel aldehyde dehydrogenase expressed in multiple subcellular compartments that protects against hyperosmotic stress by generating osmolytes and metabolizing toxic aldehydes.
Full Name
aldehyde dehydrogenase 7 family, member A1
References
  • Brocker C, et al. (2011) Aldehyde dehydrogenase 7A1 (ALDH7A1) attenuates reactive aldehyde and oxidative stress induced cytotoxicity. Chem Biol Interact. 191(1-3): 269-77.
  • Brocker C, et al. (2010) Aldehyde dehydrogenase 7A1 (ALDH7A1) is a novel enzyme involved in cellular defense against hyperosmotic stress. J Biol Chem. 285(24): 18452-63.

ALDH7A1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait