Быстрый заказ

Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь AKT3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_011785.3
    Размер кДНК:1440bp
    Описание кДНК:Full length Clone DNA of Mus musculus thymoma viral proto-oncogene 3 with C terminal Flag tag.
    Синоним гена:AI851531, D930002M15Rik, Akt3
    Виды:Mouse
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AKT3 qPCR primers for gene expression analysis, MP200986 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51027-ACGRBS15400
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51027-ACRRBS15400
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51027-ANGRBS15400
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51027-ANRRBS15400
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51027-CFRBS13340
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51027-CHRBS13340
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51027-CMRBS13340
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51027-CYRBS13340
    Мышь AKT3 Джин клон кДНК в вектор клонированияMG51027-GRBS5130
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51027-NFRBS13340
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51027-NHRBS13340
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51027-NMRBS13340
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51027-NYRBS13340
    Мышь AKT3 Джин ORF экспрессии кДНК клона плазмидыMG51027-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    v-akt murine thymoma viral oncogene homolog 3 (AKT3), also known as PKB-GAMMA, with AKT1/PKBalpha, AKT2/PKBbeta, are the memerbers of Akt kinase family, share extensive structural similarity and perform common as well as unique functions within cells. The Akt signaling cascade initiates at the cell surface when growth factors or other extracellular stimuli activate phosphoinositide 3-kinase (PI3K). AKT3 was discovered to be the predominant isoform activated in sporadic melanomas. Levels of activity increased during melanoma progression with metastatic melanomas having the highest activity. Although mechanisms of AKT3 activation remain to be fully characterized, overexpression of AKT3 and decreased PTEN activity play important roles in this process. Targeted reduction of AKT3 activity decreased survival of melanoma tumor cells leading to inhibition of tumor development, which may be therapeutically effective for shrinking tumors in melanoma patients. AKT2 and AKT3 play an important role in the viability of human malignant glioma cells. Targeting AKT2 and AKT3 may hold promise for the treatment of patients with gliomas.

    Ссылки
  • Mure H, et al. (2010) Akt2 and Akt3 play a pivotal role in malignant gliomas. Neuro Oncol. 12(3): 221-32.
  • Koseoglu S, et al. (2007) AKT1, AKT2 and AKT3-dependent cell survival is cell line-specific and knockdown of all three isoforms selectively induces apoptosis in 20 human tumor cell lines. Cancer Biol Ther. 6(5): 755-62.
  • Cristiano BE, et al. (2006) A specific role for AKT3 in the genesis of ovarian cancer through modulation of G(2)-M phase transition. Cancer Res. 66(24): 11718-25.
  • Robertson GP. (2005) Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev. 24(2): 273-85.
  • Altomare DA, et al. (2005) Perturbations of the AKT signaling pathway in human cancer. Oncogene. 24: 7455-64.
  • Stahl JM, et al. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res. 64: 7002-10.
  • Size / Price
    Каталог: MG51027-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».