Быстрый заказ

Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь AKR1B3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_009658.3
    Размер кДНК:951bp
    Описание кДНК:Full length Clone DNA of Mus musculus aldo-keto reductase family 1, member B3 (aldose reductase) with C terminal His tag.
    Синоним гена:AR, ALR2, Ahr1, Ahr-1, Aldr1, Akr1b1, Aldor1
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AKR1B3 qPCR primers for gene expression analysis, MP202156 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52283-ACGRBS15400
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52283-ACRRBS15400
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52283-ANGRBS15400
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52283-ANRRBS15400
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52283-CFRBS13340
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52283-CHRBS13340
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52283-CMRBS13340
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52283-CYRBS13340
    Мышь AKR1B3 Джин клон кДНК в вектор клонированияMG52283-GRBS5130
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52283-NFRBS13340
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52283-NHRBS13340
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52283-NMRBS13340
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52283-NYRBS13340
    Мышь AKR1B3 Джин ORF экспрессии кДНК клона плазмидыMG52283-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».