After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse AK4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001177602.1
Размер кДНК:672bp
Описание кДНК:Full length Clone DNA of Mus musculus adenylate kinase 4 with N terminal Myc tag.
Синоним гена:Ak3, AK 4, Ak-3, Ak-4, Ak3l1, D4Ertd274e
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52601-ACGRBS15400
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52601-ACRRBS15400
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52601-ANGRBS15400
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52601-ANRRBS15400
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52601-CFRBS13340
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52601-CHRBS13340
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52601-CMRBS13340
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52601-CYRBS13340
Mouse AK4 Gene cDNA clone plasmidMG52601-GRBS5130
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52601-NFRBS13340
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52601-NHRBS13340
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52601-NMRBS13340
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52601-NYRBS13340
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин клон кДНК в вектор клонированияMG52601-URBS5130
Мышь AK4 / Adenylate Kinase 4 / AK3L1 Джин ORF экспрессии кДНК клона плазмидыMG52601-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Каталог: MG52601-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».