Быстрый заказ

Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь AI464131 Информация о продукте «Клон cDNA»
    Размер кДНК:2151bp
    Описание кДНК:Full length Clone DNA of Mus musculus expressed sequence AI464131 with C terminal His tag.
    Синоним гена:Gm762, NET37, AA408153, AI604836, Kiaa1161
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with AI464131 qPCR primers for gene expression analysis, MP202155 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52282-ACGRBS16760
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52282-ACRRBS16760
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52282-CFRBS14710
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52282-CHRBS14710
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52282-CMRBS14710
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52282-CYRBS14710
    Мышь AI464131 Джин клон кДНК в вектор клонированияMG52282-GRBS5130
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52282-NFRBS14710
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52282-NHRBS14710
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52282-NMRBS14710
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52282-NYRBS14710
    Мышь AI464131 Джин ORF экспрессии кДНК клона плазмидыMG52282-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52282-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.