Быстрый заказ

Text Size:AAA

Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse AGT Информация о продукте «Клон cDNA»
Размер кДНК:1449bp
Описание кДНК:Full length Clone DNA of Mus musculus angiotensinogen (serpin peptidase inhibitor, clade A, member 8) with C terminal Myc tag.
Синоним гена:AngI, AngII, Aogen, AI265500, Serpina8
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50337-ACGRBS15400
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50337-ACRRBS15400
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50337-CFRBS13340
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50337-CHRBS13340
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50337-CMRBS13340
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50337-CYRBS13340
Мышь Angiotensinogen/SerpinA8 Джин клон кДНК в вектор клонированияMG50337-GRBS5130
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50337-NFRBS13340
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50337-NHRBS13340
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50337-NMRBS13340
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50337-NYRBS13340
Мышь Angiotensinogen/SerpinA8 Джин ORF экспрессии кДНК клона плазмидыMG50337-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Angiotensinogen, also known as AGT and SerpinA8, is a member of the serpin family. It is an α-2-globulin that is produced constitutively and released into the circulation mainly by the liver. Angiotensinogen is a essential component of the renin-angiotensin system (RAS) and a potent regulator of blood pressure. Angiotensinogen can be schematically considered to consist of a combination of an angiotensin I (Ang I) function, located at the N-terminal end, and the presence of a serpin (serine protease inhibitor) structure at the opposite end. Angiotensinogen is cleaved into three chains: Angiotensin-1 (Ang I), Angiotensin-2 (Ang II), and Angiotensin-3 (Ang III). Angiotensin-1 is a substrate of ACE (angiotensin converting enzyme) that removes a dipeptide to yield the physiologically active peptide angiotensin-2. Angiotensin-1 and angiotensin-2 can be further processed to generate angiotensin-3, angiotensin-4. Angiotensin 1-7 is cleaved from angiotensin-2 by ACE2. Angiotensin-2 acts directly on vascular smooth muscle as a potent vasoconstrictor, affects cardiac contractility and heart rate through its action on the sympathetic nervous system. Defects in AGT are associated with susceptibility to essential hypertension and renal tubular dysgenesis (RTD). Several serpins (antithrombin, maspin, pigment epithelial-derived factor, and kallistatin) have been recently shown to exert an antiangiogenic activity, suggesting a common mechanism of endothelial cell proliferation and migration. Angiotensinogen/AGT and its renin-cleaved product, des(Ang I)AGT, are also angiogenesis inhibitors, both in vitro and in vivo at concentrations within the range of those observed in plasma. The Angiotensinogen products, that is angiotensin II and possibly angiotensin II-related products, have been found to act locally in modulating adipose tissue growth in an autocrine/paracrine manner. The transient or chronic overexpression of angiotensinogen in adipose tissue favors lipogenesis in adipocytes and leads to a 'vicious' circle whereby adipose tissue development is further increased.

  • Ailhaud G, et al. (2002) Angiotensinogen, adipocyte differentiation and fat mass enlargement. Curr Opin Clin Nutr Metab Care. 5(4): 385-9.
  • Corvol P, et al. (2003) Inhibition of angiogenesis: a new function for angiotensinogen and des(angiotensin I)angiotensinogen. Curr Hypertens Rep. 5(2): 149-54.
  • Size / Price
    Каталог: MG50337-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.