Быстрый заказ

Мышь AGRP Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь AGRP Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_007427.2
    Размер кДНК:396bp
    Описание кДНК:Full length Clone DNA of Mus musculus agouti related protein.
    Синоним гена:Art, Agrt, Agrp
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AGRP qPCR primers for gene expression analysis, MP200300 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь AGRP Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Product nameProduct name
    Фон

    Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found in the hypothalamus and exhibits potent orexigenic activity. AGRP can act as a competitive antagonist to proopiomelanocortin (POMC)-derived peptides at the melanocortin-4 receptor (MC4R), and that this homeostatic mechanism is important as a means of coordinating appetite with perceived metabolic requirement. AGRP is upregulated by fasting while intracerebroventricular injections of synthetic AGRP lead to increased appetite and food intake. Thus, AGRP is a powerful orexigenic peptide that increases food intake when ubiquitously overexpressed or when administered centrally.

    Ссылки
  • Ilnytska O, et al. (2008) The role of the Agouti-Related Protein in energy balance regulation. Cell Mol Life Sci. 65(17): 2721-31.
  • Pritchard LE, et al. (2005) Agouti-related protein: more than a melanocortin-4 receptor antagonist? Peptides. 26(10): 1759-70.
  • Sttz AM, et al. (2005) The agouti-related protein and its role in energy homeostasis. Peptides. 26(10): 1771-81.
  • Millhauser GL, et al. (2003) Loops and links: structural insights into the remarkable function of the agouti-related protein. Ann N Y Acad Sci. 994: 27-35.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».