After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ADORA2A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009630.2
Размер кДНК:1233bp
Описание кДНК:Full length Clone DNA of Mus musculus adenosine A2a receptor with N terminal Myc tag.
Синоним гена:A2aR, A2AAR, AA2AR
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52586-ACGRBS15400
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52586-ACRRBS15400
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52586-CFRBS13340
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52586-CHRBS13340
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52586-CMRBS13340
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52586-CYRBS13340
Мышь Adenosine Receptor A2a Джин клон кДНК в вектор клонированияMG52586-GRBS5130
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52586-NFRBS13340
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52586-NHRBS13340
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52586-NMRBS13340
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52586-NYRBS13340
Мышь Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмидыMG52586-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52586-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».