Быстрый заказ

Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь ADAM10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013494.3
Размер кДНК:2250 bp
Описание кДНК:Full length Clone DNA of Mus musculus a disintegrin and metallopeptidase domain 10
Синоним гена:1700031C13Rik,kuz,kuzbanian,MADM
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ADAM10 qPCR primers for gene expression analysis, MP201018 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51072-ACGRBS16760
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51072-ACRRBS16760
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51072-CFRBS5130
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51072-CHRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51072-CMRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51072-CYRBS14710
Мышь ADAM10 Джин клон кДНК в вектор клонированияMG51072-GRBS5130
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51072-NFRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51072-NHRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51072-NMRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51072-NYRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмидыMG51072-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51072-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».