After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ADAM10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013494.3
Размер кДНК:2250 bp
Описание кДНК:Full length Clone DNA of Mus musculus a disintegrin and metallopeptidase domain 10
Синоним гена:1700031C13Rik,kuz,kuzbanian,MADM
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51072-ACGRBS16760
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51072-ACRRBS16760
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51072-CFRBS5130
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51072-CHRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51072-CMRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51072-CYRBS14710
Мышь ADAM10 Джин клон кДНК в вектор клонированияMG51072-GRBS5130
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51072-NFRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51072-NHRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51072-NMRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51072-NYRBS14710
Мышь ADAM10 Джин ORF экспрессии кДНК клона плазмидыMG51072-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51072-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».