After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ACTC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009608.3
Размер кДНК:1134bp
Описание кДНК:Full length Clone DNA of Mus musculus actin, alpha, cardiac muscle 1.
Синоним гена:Actc-1
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51355-ACGRBS15400
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51355-ACRRBS15396
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51355-ANGRBS15400
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51355-ANRRBS15396
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51355-CFRBS13343
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51355-CHRBS13340
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51355-CMRBS13343
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51355-CYRBS13340
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51355-NFRBS13340
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51355-NHRBS13340
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51355-NMRBS13340
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51355-NYRBS13343
Мышь ACTC1 Джин клон кДНК в вектор клонированияMG51355-URBS5132
Мышь ACTC1 Джин ORF экспрессии кДНК клона плазмидыMG51355-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51355-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».