Быстрый заказ

Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ACRBP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001127340.1
Размер кДНК:951bp
Описание кДНК:Full length Clone DNA of Mus musculus proacrosin binding protein.
Синоним гена:sp32, OY-TES-1
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52464-ACGRBS15400
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52464-ACRRBS15400
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52464-CFRBS13340
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52464-CHRBS13340
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52464-CMRBS13340
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52464-CYRBS13340
Мышь OY-TES-1 Джин клон кДНК в вектор клонированияMG52464-GRBS5130
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52464-NFRBS13340
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52464-NHRBS13340
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52464-NMRBS13340
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52464-NYRBS13340
Мышь OY-TES-1 Джин ORF экспрессии кДНК клона плазмидыMG52464-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52464-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».