After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ACP5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007388.3
Размер кДНК:984bp
Описание кДНК:Full length Clone DNA of Mus musculus acid phosphatase 5, tartrate resistant.
Синоним гена:TRAP, TRACP, Acp5
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50274-ACGRBS15400
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50274-ACRRBS15400
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50274-CFRBS13340
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50274-CHRBS13340
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50274-CMRBS13340
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50274-CYRBS13340
Мышь TRACP/ACP5 Джин клон кДНК в вектор клонированияMG50274-MRBS5130
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50274-NFRBS13340
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50274-NHRBS13340
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50274-NMRBS13340
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50274-NYRBS13340
Мышь TRACP/ACP5 Джин ORF экспрессии кДНК клона плазмидыMG50274-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

Ссылки
  • Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.
  • Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.
  • Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.
  • Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.
  • Size / Price
    Каталог: MG50274-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».