After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ACP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001110239.1
Размер кДНК:477bp
Описание кДНК:Full length Clone DNA of Mus musculus acid phosphatase 1, soluble with C terminal Flag tag.
Синоним гена:Acp-1, LMW-PTP, AI427468, 4632432E04Rik
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51014-ACGRBS15400
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51014-ACRRBS15400
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51014-ANGRBS15400
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51014-ANRRBS15400
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51014-CFRBS13340
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51014-CHRBS13340
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51014-CMRBS13340
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51014-CYRBS13340
Мышь ACP1 / LMW-PTP Джин клон кДНК в вектор клонированияMG51014-GRBS5130
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51014-NFRBS13340
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51014-NHRBS13340
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51014-NMRBS13340
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51014-NYRBS13340
Мышь ACP1 / LMW-PTP Джин ORF экспрессии кДНК клона плазмидыMG51014-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid phosphatase 1 (ACP1), belongs to the low molecular weight phosphotyrosine protein phosphatase family are involved in the regulation of important physiological functions, including stress resistance and synthesis of the polysaccharide capsule. ACP1/LMW-PTP is an enzyme involved in platelet-derived growth factor-induced mitogenesis and cytoskeleton rearrangement. LMW-PTP is able to specifically bind and dephosphorylate activated PDGF receptor, thus modulating PDGF-induced mitogenesis. In vitro, LMW-PTP was found to efficiently dephosphorylate activated FcgammaRIIA and LAT, but not Syk or phospholipase Cgamma2. The overexpression of LMW-PTP inhibited activation of Syk downstream of FcgammaRIIA and reduced intracellular Ca(2+) mobilization. It been demonstrated that LMW-PTP is responsible for FcgammaRIIA dephosphorylation, and is implicated in the down-regulation of cell activation mediated by this ITAM-bearing immunoreceptor. In addition, ACP1 is a highly polymorphic phosphatase that is especially abundant in the central nervous system and is known to be involved in several signal transduction pathways.

Ссылки
  • Cirri P, et al. (1998) Low molecular weight protein-tyrosine phosphatase tyrosine phosphorylation by c-Src during platelet-derived growth factor-induced mitogenesis correlates with its subcellular targeting. J Biol Chem. 273(49): 32522-7.
  • Chiarugi P, et al. (2002) Insight into the role of low molecular weight phosphotyrosine phosphatase (LMW-PTP) on platelet-derived growth factor receptor (PDGF-r) signaling. LMW-PTP controls PDGF-r kinase activity through TYR-857 dephosphorylation. J Biol Chem. 277(40): 37331-8.
  • Bottini N, et al. (2002) Convulsive disorder and the genetics of signal transduction; a study of a low molecular weight protein tyrosine phosphatase in a pediatric sample. Neurosci Lett. 333(3): 159-62.
  • Musumeci L, et al. (2005) Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol. 187(14): 4945-56.
  • Mancini F, et al. (2007) The low-molecular-weight phosphotyrosine phosphatase is a negative regulator of FcgammaRIIA-mediated cell activation. Blood. 110(6): 1871-8.
  • Size / Price
    Каталог: MG51014-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».