Быстрый заказ

Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь ACOT1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_012006.2
    Размер кДНК:1260bp
    Описание кДНК:Full length Clone DNA of Mus musculus acyl-CoA thioesterase 1 with C terminal His tag.
    Синоним гена:ACH2, Cte1, CTE-1, CTE-I, D12Ucla1
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACOT1 qPCR primers for gene expression analysis, MP201596 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51723-ACGRBS15400
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51723-ACRRBS15400
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51723-ANGRBS15400
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51723-ANRRBS15400
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51723-CFRBS13340
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51723-CHRBS13340
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51723-CMRBS13340
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51723-CYRBS13340
    Мышь ACOT1 Джин клон кДНК в вектор клонированияMG51723-GRBS5130
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51723-NFRBS13340
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51723-NHRBS13340
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51723-NMRBS13340
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51723-NYRBS13340
    Мышь ACOT1 Джин ORF экспрессии кДНК клона плазмидыMG51723-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51723-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».