After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ACHE Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009599.3
Размер кДНК:1844bp
Описание кДНК:Full length Clone DNA of Mus musculus acetylcholinesterase with N terminal HA tag.
Синоним гена:mE1a, mE1b, mE1c, mE1d, mE1e, mE1d', mE1c-long, Ache
Виды:Mouse
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50543-ACGRBS16760
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50543-ACRRBS16760
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50543-CFRBS14710
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50543-CHRBS14710
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50543-CMRBS14710
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50543-CYRBS14710
Мышь Acetylcholinesterase Джин клон кДНК в вектор клонированияMG50543-MRBS5130
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50543-NFRBS14710
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50543-NHRBS14710
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50543-NMRBS14710
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50543-NYRBS14710
Мышь Acetylcholinesterase Джин ORF экспрессии кДНК клона плазмидыMG50543-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Acetylcholinesterase, also known as ACHE, is an enzyme that degrades (through its hydrolytic activity) the neurotransmitter acetylcholine, producing choline and an acetate group. Acetylcholinesterase plays a crucial role in nerve impulse transmission at cholinergic synapses by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE appears to be a potential therapeutic target at muscle injuries including organophosphate myopathy. It is an externally oriented membrane-bound enzyme and its main physiological role is termination of chemical transmission at cholinergic synapses and secretory organs by rapid hydrolysis of the neurotransmitter acetylcholine (ACh). ACHE plays important roles in the cholinergic system, and its dysregulation is involved in a variety of human diseases. ACHE was significantly down-regulated in the cancerous tissues of 69.2% of hepatocellular carcinoma (HCC) patients, and the low ACHE expression in HCC was correlated with tumor aggressiveness, an elevated risk of postoperative recurrence, and a low survival rate. Both the recombinant ACHE protein and the enhanced expression of ACHE significantly inhibited HCC cell growth in vitro and tumorigenicity in vivo. ACHE as a tumor growth suppressor in regulating cell proliferation, the relevant signaling pathways, and the drug sensitivity of HCC cells. Thus, ACHE is a promising independent prognostic predictor for HCC recurrence and the survival of HCC patients. ACHE is responsible for the hydrolysis of acetylcholine in the nervous system. It is inhibited by organophosphate and carbamate pesticides. However, this enzyme is only slightly inhibited by organophosphorothionates.

Ссылки
  • Zhao Y, et al. (2011) Acetylcholinesterase, a key prognostic predictor for hepatocellular carcinoma, suppresses cell growth and induces chemosensitization. Hepatology. 53(2): 493-503.
  • Roepcke CB, et al. (2010) Analysis of phosphorothionate pesticides using a chloroperoxidase pretreatment and acetylcholinesterase biosensor detection. J Agric Food Chem. 58(15): 8748-56.
  • Zaheer-ul-Haq, et al. (2010) Benchmarking docking and scoring protocol for the identification of potential acetylcholinesterase inhibitors. J Mol Graph Model. 28(8): 870-82.
  • Pegan K, et al. (2010) Acetylcholinesterase is involved in apoptosis in the precursors of human muscle regeneration. Chem Biol Interact. 187(1-3): 96-100.
  • Size / Price
    Каталог: MG50543-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».