After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ACAT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_144784.3
Размер кДНК:1275bp
Описание кДНК:Full length Clone DNA of Mus musculus acetyl-Coenzyme A acetyltransferase 1 with C terminal His tag.
Синоним гена:Acat, 6330585C21Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52278-ACGRBS15400
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52278-ACRRBS15400
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52278-ANGRBS15400
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52278-ANRRBS15400
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52278-CFRBS13340
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52278-CHRBS13340
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52278-CMRBS13340
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52278-CYRBS13340
Мышь ACAT1 Джин клон кДНК в вектор клонированияMG52278-GRBS5130
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52278-NFRBS13340
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52278-NHRBS13340
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52278-NMRBS13340
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52278-NYRBS13340
Мышь ACAT1 Джин ORF экспрессии кДНК клона плазмидыMG52278-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52278-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».