After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ACAA1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_130864.3
Размер кДНК:1275bp
Описание кДНК:Full length Clone DNA of Mus musculus acetyl-Coenzyme A acyltransferase 1A with N terminal His tag.
Синоним гена:PTL, Acaa, Acaa1, D9Ertd25e
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52536-ACGRBS15400
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52536-ACRRBS15400
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52536-ANGRBS15400
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52536-ANRRBS15400
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52536-CFRBS13340
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52536-CHRBS13340
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52536-CMRBS13340
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52536-CYRBS13340
Мышь ACAA1A Джин клон кДНК в вектор клонированияMG52536-GRBS5130
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52536-NFRBS13340
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52536-NHRBS13340
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52536-NMRBS13340
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52536-NYRBS13340
Мышь ACAA1A Джин ORF экспрессии кДНК клона плазмидыMG52536-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52536-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».